null
Upload your supply list for instant savings Let's go!
Bulk Discount Available!
Athority Badge

MystiCq® microRNA qPCR Assay Primer, 1 X 250 reactions (MIRAP00347-250RXN)

SKU:
MIRAP00347-250RXN
$140.82
Net 30 Terms Available

Earn points on this purchase

MystiCq® microRNA qPCR Assay Primer, 1 X 250 reactions (MIRAP00347-250RXN)
*We accept purchase orders from private, public, educational, & government institutions
Current Stock:
storage temp.−20°C
mp~75.5 °C
shipped inwet ice
mature sequenceAAUAAUACAUGGUUGAUCUUU,seq:4,language:1,id:
Sanger mature/minor accession no.MIMAT0000721
Gene Informationhuman ... MIR369(442914)
formliquid
concentration10 mg/mL
Trusted quality

High quality molecular biology products trusted by researchers across the world. Browse our selection online or call us today.

Fast shipping

We offer same day shipping on common supplies and equipment to keep your research moving forward.

Newsletter

Sign up for the best experience and exclusive offers.