null
Need a cross reference? Switch & Save
Bulk Discount Available!
Athority Badge

MystiCq® microRNA qPCR Assay Primer, 1 X 250 reactions (MIRAP00197-250RXN)

SKU:
MIRAP00197-250RXN
$127.48
Net 30 Terms Available

Earn points on this purchase

MystiCq® microRNA qPCR Assay Primer, 1 X 250 reactions (MIRAP00197-250RXN)
*We accept purchase orders from private, public, educational, & government institutions
Current Stock:
storage temp.−20°C
shipped inwet ice
Gene Informationhuman ... MIR151A(442893)
Sanger mature/minor accession no.MIMAT0004697
mature sequenceUCGAGGAGCUCACAGUCUAGU,seq:4,language:1,id:
concentration10 mg/mL
mp~76.5 °C
formliquid
Trusted quality

High quality molecular biology products trusted by researchers across the world. Browse our selection online or call us today.

Fast shipping

We offer same day shipping on common supplies and equipment to keep your research moving forward.

Newsletter

Sign up for the best experience and exclusive offers.